PERLRETUT(1) Perl Programmers Reference Guide PERLRETUT(1)
NAME
perlretut - Perl regular expressions tutorial
DESCRIPTION
This page provides a basic tutorial on understanding, creating and using regular expressions in Perl. It
serves as a complement to the reference page on regular expressions perlre. Regular expressions are an
integral part of the "m//", "s///", "qr//" and "split" operators and so this tutorial also overlaps with
"Regexp Quote-Like Operators" in perlop and "split" in perlfunc.
Perl is widely renowned for excellence in text processing, and regular expressions are one of the big factors
behind this fame. Perl regular expressions display an efficiency and flexibility unknown in most other
computer languages. Mastering even the basics of regular expressions will allow you to manipulate text with
surprising ease.
What is a regular expression? A regular expression is simply a string that describes a pattern. Patterns are
in common use these days; examples are the patterns typed into a search engine to find web pages and the
patterns used to list files in a directory, e.g., "ls *.txt" or "dir *.*". In Perl, the patterns described by
regular expressions are used to search strings, extract desired parts of strings, and to do search and replace
operations.
Regular expressions have the undeserved reputation of being abstract and difficult to understand. Regular
expressions are constructed using simple concepts like conditionals and loops and are no more difficult to
understand than the corresponding "if" conditionals and "while" loops in the Perl language itself. In fact,
the main challenge in learning regular expressions is just getting used to the terse notation used to express
these concepts.
This tutorial flattens the learning curve by discussing regular expression concepts, along with their
notation, one at a time and with many examples. The first part of the tutorial will progress from the
simplest word searches to the basic regular expression concepts. If you master the first part, you will have
all the tools needed to solve about 98% of your needs. The second part of the tutorial is for those
comfortable with the basics and hungry for more power tools. It discusses the more advanced regular
expression operators and introduces the latest cutting-edge innovations.
A note: to save time, 'regular expression' is often abbreviated as regexp or regex. Regexp is a more natural
abbreviation than regex, but is harder to pronounce. The Perl pod documentation is evenly split on regexp vs
regex; in Perl, there is more than one way to abbreviate it. We'll use regexp in this tutorial.
Part 1: The basics
Simple word matching
The simplest regexp is simply a word, or more generally, a string of characters. A regexp consisting of a
word matches any string that contains that word:
"Hello World" =~ /World/; # matches
What is this Perl statement all about? "Hello World" is a simple double-quoted string. "World" is the regular
expression and the "//" enclosing "/World/" tells Perl to search a string for a match. The operator "=~"
associates the string with the regexp match and produces a true value if the regexp matched, or false if the
regexp did not match. In our case, "World" matches the second word in "Hello World", so the expression is
true. Expressions like this are useful in conditionals:
if ("Hello World" =~ /World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
$greeting = "World";
if ("Hello World" =~ /$greeting/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
If you're matching against the special default variable $_, the "$_ =~" part can be omitted:
$_ = "Hello World";
if (/World/) {
print "It matches\n";
}
else {
print "It doesn't match\n";
}
And finally, the "//" default delimiters for a match can be changed to arbitrary delimiters by putting an 'm'
out front:
"Hello World" =~ m!World!; # matches, delimited by '!'
"Hello World" =~ m{World}; # matches, note the matching '{}'
"/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
# '/' becomes an ordinary char
"/World/", "m!World!", and "m{World}" all represent the same thing. When, e.g., the quote (""") is used as a
delimiter, the forward slash '/' becomes an ordinary character and can be used in this regexp without trouble.
Let's consider how different regexps would match "Hello World":
"Hello World" =~ /world/; # doesn't match
"Hello World" =~ /o W/; # matches
"Hello World" =~ /oW/; # doesn't match
"Hello World" =~ /World /; # doesn't match
The first regexp "world" doesn't match because regexps are case-sensitive. The second regexp matches because
the substring 'o W' occurs in the string "Hello World". The space character ' ' is treated like any other
character in a regexp and is needed to match in this case. The lack of a space character is the reason the
third regexp 'oW' doesn't match. The fourth regexp 'World ' doesn't match because there is a space at the end
of the regexp, but not at the end of the string. The lesson here is that regexps must match a part of the
string exactly in order for the statement to be true.
If a regexp matches in more than one place in the string, Perl will always match at the earliest possible
point in the string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
"That hat is red" =~ /hat/; # matches 'hat' in 'That'
With respect to character matching, there are a few more points you need to know about. First of all, not
all characters can be used 'as is' in a match. Some characters, called metacharacters, are reserved for use
in regexp notation. The metacharacters are
{}[]()^$.|*+?\
"#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
The backslash character '\' is a metacharacter itself and needs to be backslashed:
'C:\WIN32' =~ /C:\\WIN/; # matches
In addition to the metacharacters, there are some ASCII characters which don't have printable character
equivalents and are instead represented by escape sequences. Common examples are "\t" for a tab, "\n" for a
newline, "\r" for a carriage return and "\a" for a bell (or alert). If your string is better thought of as a
sequence of arbitrary bytes, the octal escape sequence, e.g., "\033", or hexadecimal escape sequence, e.g.,
"\x1B" may be a more natural representation for your bytes. Here are some examples of escapes:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
"cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
# to spell cat
If you've been around Perl a while, all this talk of escape sequences may seem familiar. Similar escape
sequences are used in double-quoted strings and in fact the regexps in Perl are mostly treated as double-
quoted strings. This means that variables can be used in regexps as well. Just like double-quoted strings,
the values of the variables in the regexp will be substituted in before the regexp is evaluated for matching
purposes. So we have:
$foo = 'house';
'housecat' =~ /$foo/; # matches
'cathouse' =~ /cat$foo/; # matches
'housecat' =~ /${foo}cat/; # matches
So far, so good. With the knowledge above you can already perform searches with just about any literal string
regexp you can dream up. Here is a very simple emulation of the Unix grep program:
% cat > simple_grep
#!/usr/bin/perl
$regexp = shift;
while (<>) {
print if /$regexp/;
}
^D
% chmod +x simple_grep
% simple_grep abba /usr/dict/words
Babbage
cabbage
cabbages
sabbath
Sabbathize
Sabbathizes
sabbatical
scabbard
scabbards
"housekeeper" =~ /keeper/; # matches
"housekeeper" =~ /^keeper/; # doesn't match
"housekeeper" =~ /keeper$/; # matches
"housekeeper\n" =~ /keeper$/; # matches
The second regexp doesn't match because "^" constrains "keeper" to match only at the beginning of the string,
but "housekeeper" has keeper starting in the middle. The third regexp does match, since the "$" constrains
"keeper" to match only at the end of the string.
When both "^" and "$" are used at the same time, the regexp has to match both the beginning and the end of the
string, i.e., the regexp matches the whole string. Consider
"keeper" =~ /^keep$/; # doesn't match
"keeper" =~ /^keeper$/; # matches
"" =~ /^$/; # ^$ matches an empty string
The first regexp doesn't match because the string has more to it than "keep". Since the second regexp is
exactly the string, it matches. Using both "^" and "$" in a regexp forces the complete string to match, so it
gives you complete control over which strings match and which don't. Suppose you are looking for a fellow
named bert, off in a string by himself:
"dogbert" =~ /bert/; # matches, but not what you want
"dilbert" =~ /^bert/; # doesn't match, but ..
"bertram" =~ /^bert/; # matches, so still not good enough
"bertram" =~ /^bert$/; # doesn't match, good
"dilbert" =~ /^bert$/; # doesn't match, good
"bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just as easily use the string comparison
"$string eq 'bert'" and it would be more efficient. The "^...$" regexp really becomes useful when we add in
the more powerful regexp tools below.
Using character classes
Although one can already do quite a lot with the literal string regexps above, we've only scratched the
surface of regular expression technology. In this and subsequent sections we will introduce regexp concepts
(and associated metacharacter notations) that will allow a regexp to represent not just a single character
sequence, but a whole class of them.
One such concept is that of a character class. A character class allows a set of possible characters, rather
than just a single character, to match at a particular point in a regexp. Character classes are denoted by
brackets "[...]", with the set of characters to be possibly matched inside. Here are some examples:
/cat/; # matches 'cat'
/[bcr]at/; # matches 'bat, 'cat', or 'rat'
/item[0123456789]/; # matches 'item0' or ... or 'item9'
"abc" =~ /[cab]/; # matches 'a'
In the last statement, even though 'c' is the first character in the class, 'a' matches because the first
character position in the string is the earliest point at which the regexp can match.
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
how the special characters "]$\" are handled:
/[\]c]def/; # matches ']def' or 'cdef'
$x = 'bcr';
/[$x]at/; # matches 'bat', 'cat', or 'rat'
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
The last two are a little tricky. In "[\$x]", the backslash protects the dollar sign, so the character class
has two members "$" and "x". In "[\\$x]", the backslash is protected, so $x is treated as a variable and
substituted in double quote fashion.
The special character '-' acts as a range operator within character classes, so that a contiguous set of
characters can be written as a range. With ranges, the unwieldy "[0123456789]" and "[abc...xyz]" become the
svelte "[0-9]" and "[a-z]". Some examples are
/item[0-9]/; # matches 'item0' or ... or 'item9'
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
/[0-9a-zA-Z_]/; # matches a "word" character,
# like those in a Perl variable name
If '-' is the first or last character in a character class, it is treated as an ordinary character; "[-ab]",
"[ab-]" and "[a\-b]" are all equivalent.
The special character "^" in the first position of a character class denotes a negated character class, which
matches any character but those in the brackets. Both "[...]" and "[^...]" must match a character, or the
match fails. Then
/[^a]at/; # doesn't match 'aat' or 'at', but matches
# all other 'bat', 'cat, '0at', '%at', etc.
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
Now, even "[0-9]" can be a bother to write multiple times, so in the interest of saving keystrokes and making
regexps more readable, Perl has several abbreviations for common character classes, as shown below. Since the
introduction of Unicode, unless the "//a" modifier is in effect, these character classes match more than just
a few characters in the ASCII range.
· \d matches a digit, not just [0-9] but also digits from non-roman scripts
· \s matches a whitespace character, the set [\ \t\r\n\f] and others
· \w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_] but also digits and characters from
non-roman scripts
· \D is a negated \d; it represents any other character than a digit, or [^\d]
· \S is a negated \s; it represents any non-whitespace character [^\s]
· \W is a negated \w; it represents any non-word character [^\w]
· The period '.' matches any character but "\n" (unless the modifier "//s" is in effect, as explained
use:
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
/\w\W\w/; # matches a word char, followed by a
# non-word char, followed by a word char
/..rt/; # matches any two chars, followed by 'rt'
/end\./; # matches 'end.'
/end[.]/; # same thing, matches 'end.'
Because a period is a metacharacter, it needs to be escaped to match as an ordinary period. Because, for
example, "\d" and "\w" are sets of characters, it is incorrect to think of "[^\d\w]" as "[\D\W]"; in fact
"[^\d\w]" is the same as "[^\w]", which is the same as "[\W]". Think DeMorgan's laws.
An anchor useful in basic regexps is the word anchor "\b". This matches a boundary between a word character
and a non-word character "\w\W" or "\W\w":
$x = "Housecat catenates house and cat";
$x =~ /cat/; # matches cat in 'housecat'
$x =~ /\bcat/; # matches cat in 'catenates'
$x =~ /cat\b/; # matches cat in 'housecat'
$x =~ /\bcat\b/; # matches 'cat' at end of string
Note in the last example, the end of the string is considered a word boundary.
You might wonder why '.' matches everything but "\n" - why not every character? The reason is that often one
is matching against lines and would like to ignore the newline characters. For instance, while the string
"\n" represents one line, we would like to think of it as empty. Then
"" =~ /^$/; # matches
"\n" =~ /^$/; # matches, $ anchors before "\n"
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
"a\n" =~ /^.$/; # matches, $ anchors before "\n"
This behavior is convenient, because we usually want to ignore newlines when we count and match characters in
a line. Sometimes, however, we want to keep track of newlines. We might even want "^" and "$" to anchor at
the beginning and end of lines within the string, rather than just the beginning and end of the string. Perl
allows us to choose between ignoring and paying attention to newlines by using the "//s" and "//m" modifiers.
"//s" and "//m" stand for single line and multi-line and they determine whether a string is to be treated as
one continuous string, or as a set of lines. The two modifiers affect two aspects of how the regexp is
interpreted: 1) how the '.' character class is defined, and 2) where the anchors "^" and "$" are able to
match. Here are the four possible combinations:
· no modifiers (//): Default behavior. '.' matches any character except "\n". "^" matches only at the
beginning of the string and "$" matches only at the end or before a newline at the end.
· s modifier (//s): Treat string as a single long line. '.' matches any character, even "\n". "^" matches
only at the beginning of the string and "$" matches only at the end or before a newline at the end.
· m modifier (//m): Treat string as a set of multiple lines. '.' matches any character except "\n". "^"
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /^Who/sm; # matches, "Who" at start of second line
$x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/s; # matches, "." matches "\n"
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"
Most of the time, the default behavior is what is wanted, but "//s" and "//m" are occasionally very useful.
If "//m" is being used, the start of the string can still be matched with "\A" and the end of the string can
still be matched with the anchors "\Z" (matches both the end and the newline before, like "$"), and "\z"
(matches only the end):
$x =~ /^Who/m; # matches, "Who" at start of second line
$x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
$x =~ /girl$/m; # matches, "girl" at end of first line
$x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
$x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
$x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
We now know how to create choices among classes of characters in a regexp. What about choices among words or
character strings? Such choices are described in the next section.
Matching this or that
Sometimes we would like our regexp to be able to match different possible words or character strings. This is
accomplished by using the alternation metacharacter "|". To match "dog" or "cat", we form the regexp
"dog|cat". As before, Perl will try to match the regexp at the earliest possible point in the string. At
each character position, Perl will first try to match the first alternative, "dog". If "dog" doesn't match,
Perl will then try the next alternative, "cat". If "cat" doesn't match either, then the match fails and Perl
moves to the next position in the string. Some examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
"cats and dogs" =~ /dog|cat|bird/; # matches "cat"
Even though "dog" is the first alternative in the second regexp, "cat" is able to match earlier in the string.
"cats" =~ /c|ca|cat|cats/; # matches "c"
"cats" =~ /cats|cat|ca|c/; # matches "cats"
Here, all the alternatives match at the first string position, so the first alternative is the one that
matches. If some of the alternatives are truncations of the others, put the longest ones first to give them a
chance to match.
"cab" =~ /a|b|c/ # matches "c"
# /a|b|c/ == /[abc]/
The last example points out that character classes are like alternations of characters. At a given character
position, the first alternative that allows the regexp match to succeed will be the one that matches.
Grouping things and hierarchical matching
Alternation allows a regexp to choose among alternatives, but by itself it is unsatisfying. The reason is
that each alternative is a whole regexp, but sometime we want alternatives for just part of a regexp. For
/(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
/house(cat|)/; # matches either 'housecat' or 'house'
/house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
# 'house'. Note groups can be nested.
/(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
"20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
# because '20\d\d' can't match
Alternations behave the same way in groups as out of them: at a given string position, the leftmost
alternative that allows the regexp to match is taken. So in the last example at the first string position,
"20" matches the second alternative, but there is nothing left over to match the next two digits "\d\d". So
Perl moves on to the next alternative, which is the null alternative and that works, since "20" is two digits.
The process of trying one alternative, seeing if it matches, and moving on to the next alternative, while
going back in the string from where the previous alternative was tried, if it doesn't, is called backtracking.
The term 'backtracking' comes from the idea that matching a regexp is like a walk in the woods. Successfully
matching a regexp is like arriving at a destination. There are many possible trailheads, one for each string
position, and each one is tried in order, left to right. From each trailhead there may be many paths, some of
which get you there, and some which are dead ends. When you walk along a trail and hit a dead end, you have
to backtrack along the trail to an earlier point to try another trail. If you hit your destination, you stop
immediately and forget about trying all the other trails. You are persistent, and only if you have tried all
the trails from all the trailheads and not arrived at your destination, do you declare failure. To be
concrete, here is a step-by-step analysis of what Perl does when it tries to match the regexp
"abcde" =~ /(abd|abc)(df|d|de)/;
0 Start with the first letter in the string 'a'.
1 Try the first alternative in the first group 'abd'.
2 Match 'a' followed by 'b'. So far so good.
3 'd' in the regexp doesn't match 'c' in the string - a dead end. So backtrack two characters and pick the
second alternative in the first group 'abc'.
4 Match 'a' followed by 'b' followed by 'c'. We are on a roll and have satisfied the first group. Set $1 to
'abc'.
5 Move on to the second group and pick the first alternative 'df'.
6 Match the 'd'.
7 'f' in the regexp doesn't match 'e' in the string, so a dead end. Backtrack one character and pick the
second alternative in the second group 'd'.
8 'd' matches. The second grouping is satisfied, so set $2 to 'd'.
9 We are at the end of the regexp, so we are done! We have matched 'abcd' out of the string "abcde".
There are a couple of things to note about this analysis. First, the third alternative in the second group
'de' also allows a match, but we stopped before we got to it - at a given character position, leftmost wins.
Second, we were able to get a match at the first character position of the string 'a'. If there were no
They can be used just as ordinary variables:
# extract hours, minutes, seconds
if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
$hours = $1;
$minutes = $2;
$seconds = $3;
}
Now, we know that in scalar context, "$time =~ /(\d\d):(\d\d):(\d\d)/" returns a true or false value. In list
context, however, it returns the list of matched values "($1,$2,$3)". So we could write the code more
compactly as
# extract hours, minutes, seconds
($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
If the groupings in a regexp are nested, $1 gets the group with the leftmost opening parenthesis, $2 the next
opening parenthesis, etc. Here is a regexp with nested groups:
/(ab(cd|ef)((gi)|j))/;
1 2 34
If this regexp matches, $1 contains a string starting with 'ab', $2 is either set to 'cd' or 'ef', $3 equals
either 'gi' or 'j', and $4 is either set to 'gi', just like $3, or it remains undefined.
For convenience, Perl sets $+ to the string held by the highest numbered $1, $2,... that got assigned (and,
somewhat related, $^N to the value of the $1, $2,... most-recently assigned; i.e. the $1, $2,... associated
with the rightmost closing parenthesis used in the match).
Backreferences
Closely associated with the matching variables $1, $2, ... are the backreferences "\g1", "\g2",...
Backreferences are simply matching variables that can be used inside a regexp. This is a really nice feature;
what matches later in a regexp is made to depend on what matched earlier in the regexp. Suppose we wanted to
look for doubled words in a text, like 'the the'. The following regexp finds all 3-letter doubles with a
space in between:
/\b(\w\w\w)\s\g1\b/;
The grouping assigns a value to \g1, so that the same 3-letter sequence is used for both parts.
A similar task is to find words consisting of two identical parts:
% simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
beriberi
booboo
coco
mama
murmur
papa
The regexp has a single grouping which considers 4-letter combinations, then 3-letter combinations, etc., and
uses "\g1" to look for a repeat. Although $1 and "\g1" represent the same thing, care should be taken to use
matched variables $1, $2,... only outside a regexp and backreferences "\g1", "\g2",... only inside a regexp;
not doing so may lead to surprising and unsatisfactory results.
Now that we have this pattern stored as a handy string, we might feel tempted to use it as a part of some
other pattern:
$line = "code=e99e";
if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
print "$1 is valid\n";
} else {
print "bad line: '$line'\n";
}
But this doesn't match, at least not the way one might expect. Only after inserting the interpolated $a99a and
looking at the resulting full text of the regexp is it obvious that the backreferences have backfired. The
subexpression "(\w+)" has snatched number 1 and demoted the groups in $a99a by one rank. This can be avoided
by using relative backreferences:
$a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
Named backreferences
Perl 5.10 also introduced named capture groups and named backreferences. To attach a name to a capturing
group, you write either "(?<name>...)" or "(?'name'...)". The backreference may then be written as
"\g{name}". It is permissible to attach the same name to more than one group, but then only the leftmost one
of the eponymous set can be referenced. Outside of the pattern a named capture group is accessible through
the "%+" hash.
Assuming that we have to match calendar dates which may be given in one of the three formats yyyy-mm-dd,
mm/dd/yyyy or dd.mm.yyyy, we can write three suitable patterns where we use 'd', 'm' and 'y' respectively as
the names of the groups capturing the pertaining components of a date. The matching operation combines the
three patterns as alternatives:
$fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
$fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
$fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
print "day=$+{d} month=$+{m} year=$+{y}\n";
}
}
If any of the alternatives matches, the hash "%+" is bound to contain the three key-value pairs.
Alternative capture group numbering
Yet another capturing group numbering technique (also as from Perl 5.10) deals with the problem of referring
to groups within a set of alternatives. Consider a pattern for matching a time of the day, civil or military
style:
if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
# process hour and minute
}
Processing the results requires an additional if statement to determine whether $1 and $2 or $3 and $4 contain
the goodies. It would be easier if we could use group numbers 1 and 2 in second alternative as well, and this
is exactly what the parenthesized construct "(?|...)", set around an alternative achieves. Here is an extended
version of the previous pattern:
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
foreach $expr (1..$#-) {
print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
}
prints
Match 1: 'Mmm' at position (0,3)
Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still possible to find out what exactly matched in a string.
If you use them, Perl will set "$`" to the part of the string before the match, will set $& to the part of the
string that matched, and will set "$'" to the part of the string after the match. An example:
$x = "the cat caught the mouse";
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
In the second match, "$`" equals '' because the regexp matched at the first character position in the string
and stopped; it never saw the second 'the'. It is important to note that using "$`" and "$'" slows down
regexp matching quite a bit, while $& slows it down to a lesser extent, because if they are used in one regexp
in a program, they are generated for all regexps in the program. So if raw performance is a goal of your
application, they should be avoided. If you need to extract the corresponding substrings, use "@-" and "@+"
instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )
As of Perl 5.10, the "${^PREMATCH}", "${^MATCH}" and "${^POSTMATCH}" variables may be used. These are only set
if the "/p" modifier is present. Consequently they do not penalize the rest of the program.
Non-capturing groupings
A group that is required to bundle a set of alternatives may or may not be useful as a capturing group. If it
isn't, it just creates a superfluous addition to the set of available capture group values, inside as well as
outside the regexp. Non-capturing groupings, denoted by "(?:regexp)", still allow the regexp to be treated as
a single unit, but don't establish a capturing group at the same time. Both capturing and non-capturing
groupings are allowed to co-exist in the same regexp. Because there is no extraction, non-capturing groupings
are faster than capturing groupings. Non-capturing groupings are also handy for choosing exactly which parts
of a regexp are to be extracted to matching variables:
# match a number, $1-$4 are set, but we only want $1
/([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
# match a number faster , only $1 is set
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
# match a number, get $1 = whole number, $2 = exponent
/([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
Non-capturing groupings are also useful for removing nuisance elements gathered from a split operation where
parentheses are required for some reason:
are put immediately after the character, character class, or grouping that we want to specify. They have the
following meanings:
· "a?" means: match 'a' 1 or 0 times
· "a*" means: match 'a' 0 or more times, i.e., any number of times
· "a+" means: match 'a' 1 or more times, i.e., at least once
· "a{n,m}" means: match at least "n" times, but not more than "m" times.
· "a{n,}" means: match at least "n" or more times
· "a{n}" means: match exactly "n" times
Here are some examples:
/[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
# any number of digits
/(\w+)\s+\g1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
$year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
# than 4 digits
$year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
$year =~ /^\d{2}(\d{2})?$/; # same thing written differently. However,
# this captures the last two digits in $1
# and the other does not.
% simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
mama
murmur
papa
For all of these quantifiers, Perl will try to match as much of the string as possible, while still allowing
the regexp to succeed. Thus with "/a?.../", Perl will first try to match the regexp with the "a" present; if
that fails, Perl will try to match the regexp without the "a" present. For the quantifier "*", we get the
following:
$x = "the cat in the hat";
$x =~ /^(.*)(cat)(.*)$/; # matches,
# $1 = 'the '
# $2 = 'cat'
# $3 = ' in the hat'
Which is what we might expect, the match finds the only "cat" in the string and locks onto it. Consider,
however, this regexp:
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
# $3 = '' (0 characters match)
· Principle 0: Taken as a whole, any regexp will be matched at the earliest possible position in the string.
· Principle 1: In an alternation "a|b|c...", the leftmost alternative that allows a match for the whole
regexp will be the one used.
· Principle 2: The maximal matching quantifiers "?", "*", "+" and "{n,m}" will in general match as much of
the string as possible while still allowing the whole regexp to match.
· Principle 3: If there are two or more elements in a regexp, the leftmost greedy quantifier, if any, will
match as much of the string as possible while still allowing the whole regexp to match. The next leftmost
greedy quantifier, if any, will try to match as much of the string remaining available to it as possible,
while still allowing the whole regexp to match. And so on, until all the regexp elements are satisfied.
As we have seen above, Principle 0 overrides the others. The regexp will be matched as early as possible, with
the other principles determining how the regexp matches at that earliest character position.
Here is an example of these principles in action:
$x = "The programming republic of Perl";
$x =~ /^(.+)(e|r)(.*)$/; # matches,
# $1 = 'The programming republic of Pe'
# $2 = 'r'
# $3 = 'l'
This regexp matches at the earliest string position, 'T'. One might think that "e", being leftmost in the
alternation, would be matched, but "r" produces the longest string in the first quantifier.
$x =~ /(m{1,2})(.*)$/; # matches,
# $1 = 'mm'
# $2 = 'ing republic of Perl'
Here, The earliest possible match is at the first 'm' in "programming". "m{1,2}" is the first quantifier, so
it gets to match a maximal "mm".
$x =~ /.*(m{1,2})(.*)$/; # matches,
# $1 = 'm'
# $2 = 'ing republic of Perl'
Here, the regexp matches at the start of the string. The first quantifier ".*" grabs as much as possible,
leaving just a single 'm' for the second quantifier "m{1,2}".
$x =~ /(.?)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Here, ".?" eats its maximal one character at the earliest possible position in the string, 'a' in
"programming", leaving "m{1,2}" the opportunity to match both "m"'s. Finally,
"aXXXb" =~ /(X*)/; # matches with $1 = ''
because it can match zero copies of 'X' at the beginning of the string. If you definitely want to match at
least one 'X', use "X+", not "X*".
· "a{n,m}?" means: match at least "n" times, not more than "m" times, as few times as possible
· "a{n,}?" means: match at least "n" times, but as few times as possible
· "a{n}?" means: match exactly "n" times. Because we match exactly "n" times, "a{n}?" is equivalent to
"a{n}" and is just there for notational consistency.
Let's look at the example above, but with minimal quantifiers:
$x = "The programming republic of Perl";
$x =~ /^(.+?)(e|r)(.*)$/; # matches,
# $1 = 'Th'
# $2 = 'e'
# $3 = ' programming republic of Perl'
The minimal string that will allow both the start of the string "^" and the alternation to match is "Th", with
the alternation "e|r" matching "e". The second quantifier ".*" is free to gobble up the rest of the string.
$x =~ /(m{1,2}?)(.*?)$/; # matches,
# $1 = 'm'
# $2 = 'ming republic of Perl'
The first string position that this regexp can match is at the first 'm' in "programming". At this position,
the minimal "m{1,2}?" matches just one 'm'. Although the second quantifier ".*?" would prefer to match no
characters, it is constrained by the end-of-string anchor "$" to match the rest of the string.
$x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
# $1 = 'The progra'
# $2 = 'm'
# $3 = 'ming republic of Perl'
In this regexp, you might expect the first minimal quantifier ".*?" to match the empty string, because it is
not constrained by a "^" anchor to match the beginning of the word. Principle 0 applies here, however.
Because it is possible for the whole regexp to match at the start of the string, it will match at the start of
the string. Thus the first quantifier has to match everything up to the first "m". The second minimal
quantifier matches just one "m" and the third quantifier matches the rest of the string.
$x =~ /(.??)(m{1,2})(.*)$/; # matches,
# $1 = 'a'
# $2 = 'mm'
# $3 = 'ing republic of Perl'
Just as in the previous regexp, the first quantifier ".??" can match earliest at position 'a', so it does.
The second quantifier is greedy, so it matches "mm", and the third matches the rest of the string.
We can modify principle 3 above to take into account non-greedy quantifiers:
· Principle 3: If there are two or more elements in a regexp, the leftmost greedy (non-greedy) quantifier,
if any, will match as much (little) of the string as possible while still allowing the whole regexp to
match. The next leftmost greedy (non-greedy) quantifier, if any, will try to match as much (little) of
the string remaining available to it as possible, while still allowing the whole regexp to match. And so
on, until all the regexp elements are satisfied.
Just like alternation, quantifiers are also susceptible to backtracking. Here is a step-by-step analysis of
2 'a' in the regexp element 'at' doesn't match the end of the string. Backtrack one character.
3 'a' in the regexp element 'at' still doesn't match the last letter of the string 't', so backtrack one
more character.
4 Now we can match the 'a' and the 't'.
5 Move on to the third element '.*'. Since we are at the end of the string and '.*' can match 0 times,
assign it the empty string.
6 We are done!
Most of the time, all this moving forward and backtracking happens quickly and searching is fast. There are
some pathological regexps, however, whose execution time exponentially grows with the size of the string. A
typical structure that blows up in your face is of the form
/(a|b+)*/;
The problem is the nested indeterminate quantifiers. There are many different ways of partitioning a string
of length n between the "+" and "*": one repetition with "b+" of length n, two repetitions with the first "b+"
length k and the second with length n-k, m repetitions whose bits add up to length n, etc. In fact there are
an exponential number of ways to partition a string as a function of its length. A regexp may get lucky and
match early in the process, but if there is no match, Perl will try every possibility before giving up. So be
careful with nested "*"'s, "{n,m}"'s, and "+"'s. The book Mastering Regular Expressions by Jeffrey Friedl
gives a wonderful discussion of this and other efficiency issues.
Possessive quantifiers
Backtracking during the relentless search for a match may be a waste of time, particularly when the match is
bound to fail. Consider the simple pattern
/^\w+\s+\w+$/; # a word, spaces, a word
Whenever this is applied to a string which doesn't quite meet the pattern's expectations such as "abc " or
"abc def ", the regex engine will backtrack, approximately once for each character in the string. But we
know that there is no way around taking all of the initial word characters to match the first repetition, that
all spaces must be eaten by the middle part, and the same goes for the second word.
With the introduction of the possessive quantifiers in Perl 5.10, we have a way of instructing the regex
engine not to backtrack, with the usual quantifiers with a "+" appended to them. This makes them greedy as
well as stingy; once they succeed they won't give anything back to permit another solution. They have the
following meanings:
· "a{n,m}+" means: match at least "n" times, not more than "m" times, as many times as possible, and don't
give anything up. "a?+" is short for "a{0,1}+"
· "a{n,}+" means: match at least "n" times, but as many times as possible, and don't give anything up. "a*+"
is short for "a{0,}+" and "a++" is short for "a{1,}+".
· "a{n}+" means: match exactly "n" times. It is just there for notational consistency.
These possessive quantifiers represent a special case of a more general concept, the independent
subexpression, see below.
As an example where a possessive quantifier is suitable we consider matching a quoted string, as it appears in
case, we want to match both integers and floating point numbers and we want to reject any string that isn't a
number.
The next task is to break the problem down into smaller problems that are easily converted into a regexp.
The simplest case is integers. These consist of a sequence of digits, with an optional sign in front. The
digits we can represent with "\d+" and the sign can be matched with "[+-]". Thus the integer regexp is
/[+-]?\d+/; # matches integers
A floating point number potentially has a sign, an integral part, a decimal point, a fractional part, and an
exponent. One or more of these parts is optional, so we need to check out the different possibilities.
Floating point numbers which are in proper form include 123., 0.345, .34, -1e6, and 25.4E-72. As with
integers, the sign out front is completely optional and can be matched by "[+-]?". We can see that if there
is no exponent, floating point numbers must have a decimal point, otherwise they are integers. We might be
tempted to model these with "\d*\.\d*", but this would also match just a single decimal point, which is not a
number. So the three cases of floating point number without exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
/[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
These can be combined into a single regexp with a three-way alternation:
/[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
In this alternation, it is important to put '\d+\.\d+' before '\d+\.'. If '\d+\.' were first, the regexp
would happily match that and ignore the fractional part of the number.
Now consider floating point numbers with exponents. The key observation here is that both integers and
numbers with decimal points are allowed in front of an exponent. Then exponents, like the overall sign, are
independent of whether we are matching numbers with or without decimal points, and can be 'decoupled' from the
mantissa. The overall form of the regexp now becomes clear:
/^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
The exponent is an "e" or "E", followed by an integer. So the exponent regexp is
/[eE][+-]?\d+/; # exponent
Putting all the parts together, we get a regexp that matches numbers:
/^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
Long regexps like this may impress your friends, but can be hard to decipher. In complex situations like
this, the "//x" modifier for a match is invaluable. It allows one to put nearly arbitrary whitespace and
comments into a regexp without affecting their meaning. Using it, we can rewrite our 'extended' regexp in the
more pleasing form
/^
[+-]? # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
[+-]?\ * # first, match an optional sign *and space*
( # then match integers or f.p. mantissas:
\d+\.\d+ # mantissa of the form a.b
|\d+\. # mantissa of the form a.
|\.\d+ # mantissa of the form .b
|\d+ # integer of the form a
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
In this form, it is easier to see a way to simplify the alternation. Alternatives 1, 2, and 4 all start with
"\d+", so it could be factored out:
/^
[+-]?\ * # first, match an optional sign
( # then match integers or f.p. mantissas:
\d+ # start out with a ...
(
\.\d* # mantissa of the form a.b or a.
)? # ? takes care of integers of the form a
|\.\d+ # mantissa of the form .b
)
([eE][+-]?\d+)? # finally, optionally match an exponent
$/x;
or written in the compact form,
/^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
This is our final regexp. To recap, we built a regexp by
· specifying the task in detail,
· breaking down the problem into smaller parts,
· translating the small parts into regexps,
· combining the regexps,
· and optimizing the final combined regexp.
These are also the typical steps involved in writing a computer program. This makes perfect sense, because
regular expressions are essentially programs written in a little computer language that specifies patterns.
Using regular expressions in Perl
The last topic of Part 1 briefly covers how regexps are used in Perl programs. Where do they fit into Perl
syntax?
We have already introduced the matching operator in its default "/regexp/" and arbitrary delimiter "m!regexp!"
forms. We have used the binding operator "=~" and its negation "!~" to test for string matches. Associated
with the matching operator, we have discussed the single line "//s", multi-line "//m", case-insensitive "//i"
and extended "//x" modifiers. There are a few more things you might want to know about matching operators.
Prohibiting substitution
"dog" =~ /d/; # 'd' matches
"dogbert =~ //; # this matches the 'd' regexp used before
Global matching
The final two modifiers we will discuss here, "//g" and "//c", concern multiple matches. The modifier "//g"
stands for global matching and allows the matching operator to match within a string as many times as
possible. In scalar context, successive invocations against a string will have "//g" jump from match to
match, keeping track of position in the string as it goes along. You can get or set the position with the
"pos()" function.
The use of "//g" is shown in the following example. Suppose we have a string that consists of words separated
by spaces. If we know how many words there are in advance, we could extract the words using groupings:
$x = "cat dog house"; # 3 words
$x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
# $1 = 'cat'
# $2 = 'dog'
# $3 = 'house'
But what if we had an indeterminate number of words? This is the sort of task "//g" was made for. To extract
all words, form the simple regexp "(\w+)" and loop over all matches with "/(\w+)/g":
while ($x =~ /(\w+)/g) {
print "Word is $1, ends at position ", pos $x, "\n";
}
prints
Word is cat, ends at position 3
Word is dog, ends at position 7
Word is house, ends at position 13
A failed match or changing the target string resets the position. If you don't want the position reset after
failure to match, add the "//c", as in "/regexp/gc". The current position in the string is associated with
the string, not the regexp. This means that different strings have different positions and their respective
positions can be set or read independently.
In list context, "//g" returns a list of matched groupings, or if there are no groupings, a list of matches to
the whole regexp. So if we wanted just the words, we could use
@words = ($x =~ /(\w+)/g); # matches,
# $words[0] = 'cat'
# $words[1] = 'dog'
# $words[2] = 'house'
Closely associated with the "//g" modifier is the "\G" anchor. The "\G" anchor matches at the point where the
previous "//g" match left off. "\G" allows us to easily do context-sensitive matching:
$metric = 1; # use metric units
...
$x = <FILE>; # read in measurement
$x =~ /^([+-]?\d+)\s*/g; # get magnitude
$weight = $1;
"\G" is also invaluable in processing fixed-length records with regexps. Suppose we have a snippet of coding
region DNA, encoded as base pair letters "ATCGTTGAAT..." and we want to find all the stop codons "TGA". In a
coding region, codons are 3-letter sequences, so we can think of the DNA snippet as a sequence of 3-letter
records. The naive regexp
# expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
doesn't work; it may match a "TGA", but there is no guarantee that the match is aligned with codon boundaries,
e.g., the substring "GTT GAA" gives a match. A better solution is
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
which prints
Got a TGA stop codon at position 18
Got a TGA stop codon at position 23
Position 18 is good, but position 23 is bogus. What happened?
The answer is that our regexp works well until we get past the last real match. Then the regexp will fail to
match a synchronized "TGA" and start stepping ahead one character position at a time, not what we want. The
solution is to use "\G" to anchor the match to the codon alignment:
while ($dna =~ /\G(\w\w\w)*?TGA/g) {
print "Got a TGA stop codon at position ", pos $dna, "\n";
}
This prints
Got a TGA stop codon at position 18
which is the correct answer. This example illustrates that it is important not only to match what is desired,
but to reject what is not desired.
(There are other regexp modifiers that are available, such as "//o", but their specialized uses are beyond the
scope of this introduction. )
Search and replace
Regular expressions also play a big role in search and replace operations in Perl. Search and replace is
accomplished with the "s///" operator. The general form is "s/regexp/replacement/modifiers", with everything
we know about regexps and modifiers applying in this case as well. The "replacement" is a Perl double-quoted
string that replaces in the string whatever is matched with the "regexp". The operator "=~" is also used here
to associate a string with "s///". If matching against $_, the "$_ =~" can be dropped. If there is a match,
"s///" returns the number of substitutions made; otherwise it returns false. Here are a few examples:
$x = "Time to feed the cat!";
$x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
$more_insistent = 1;
# $x contains "I batted four for 4"
$x = "I batted 4 for 4";
$x =~ s/4/four/g; # does it all:
# $x contains "I batted four for four"
If you prefer 'regex' over 'regexp' in this tutorial, you could use the following program to replace it:
% cat > simple_replace
#!/usr/bin/perl
$regexp = shift;
$replacement = shift;
while (<>) {
s/$regexp/$replacement/g;
print;
}
^D
% simple_replace regexp regex perlretut.pod
In "simple_replace" we used the "s///g" modifier to replace all occurrences of the regexp on each line. (Even
though the regular expression appears in a loop, Perl is smart enough to compile it only once.) As with
"simple_grep", both the "print" and the "s/$regexp/$replacement/g" use $_ implicitly.
If you don't want "s///" to change your original variable you can use the non-destructive substitute modifier,
"s///r". This changes the behavior so that "s///r" returns the final substituted string (instead of the
number of substitutions):
$x = "I like dogs.";
$y = $x =~ s/dogs/cats/r;
print "$x $y\n";
That example will print "I like dogs. I like cats". Notice the original $x variable has not been affected. The
overall result of the substitution is instead stored in $y. If the substitution doesn't affect anything then
the original string is returned:
$x = "I like dogs.";
$y = $x =~ s/elephants/cougars/r;
print "$x $y\n"; # prints "I like dogs. I like dogs."
One other interesting thing that the "s///r" flag allows is chaining substitutions:
$x = "Cats are great.";
print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~ s/Frogs/Hedgehogs/r, "\n";
# prints "Hedgehogs are great."
A modifier available specifically to search and replace is the "s///e" evaluation modifier. "s///e" treats
the replacement text as Perl code, rather than a double-quoted string. The value that the code returns is
substituted for the matched substring. "s///e" is useful if you need to do a bit of computation in the
process of replacing text. This example counts character frequencies in a line:
$x = "Bill the cat";
$x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
As with the match "m//" operator, "s///" can use other delimiters, such as "s!!!" and "s{}{}", and even
"s{}//". If single quotes are used "s'''", then the regexp and replacement are treated as single-quoted
strings and there are no variable substitutions. "s///" in list context returns the same thing as in scalar
context, i.e., the number of matches.
The split function
The "split()" function is another place where a regexp is used. "split /regexp/, string, limit" separates the
"string" operand into a list of substrings and returns that list. The regexp must be designed to match
whatever constitutes the separators for the desired substrings. The "limit", if present, constrains splitting
into no more than "limit" number of strings. For example, to split a string into words, use
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
# $word[1] = 'and'
# $word[2] = 'Hobbes'
If the empty regexp "//" is used, the regexp always matches and the string is split into individual
characters. If the regexp has groupings, then the resulting list contains the matched substrings from the
groupings as well. For instance,
$x = "/usr/bin/perl";
@dirs = split m!/!, $x; # $dirs[0] = ''
# $dirs[1] = 'usr'
# $dirs[2] = 'bin'
# $dirs[3] = 'perl'
@parts = split m!(/)!, $x; # $parts[0] = ''
# $parts[1] = '/'
# $parts[2] = 'usr'
# $parts[3] = '/'
# $parts[4] = 'bin'
# $parts[5] = '/'
# $parts[6] = 'perl'
Since the first character of $x matched the regexp, "split" prepended an empty initial element to the list.
If you have read this far, congratulations! You now have all the basic tools needed to use regular expressions
to solve a wide range of text processing problems. If this is your first time through the tutorial, why not
stop here and play around with regexps a while.... Part 2 concerns the more esoteric aspects of regular
expressions and those concepts certainly aren't needed right at the start.
Part 2: Power tools
OK, you know the basics of regexps and you want to know more. If matching regular expressions is analogous to
a walk in the woods, then the tools discussed in Part 1 are analogous to topo maps and a compass, basic tools
we use all the time. Most of the tools in part 2 are analogous to flare guns and satellite phones. They
aren't used too often on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes esoteric capabilities of Perl regexps. In Part 2,
we will assume you are comfortable with the basics and concentrate on the advanced features.
More on characters, strings, and character classes
There are a number of escape sequences and character classes that we haven't covered yet.
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
$x = "I STILL KEYPUNCH CARDS FOR MY 360"
$x =~ /\Ukeypunch/; # matches punch card string
If there is no "\E", case is converted until the end of the string. The regexps "\L\u$word" or "\u\L$word"
convert the first character of $word to uppercase and the rest of the characters to lowercase.
Control characters can be escaped with "\c", so that a control-Z character would be matched with "\cZ". The
escape sequence "\Q"..."\E" quotes, or protects most non-alphabetic characters. For instance,
$x = "\QThat !^*&%~& cat!";
$x =~ /\Q!^*&%~&\E/; # check for rough language
It does not protect "$" or "@", so that variables can still be substituted.
"\Q", "\L", "\l", "\U", "\u" and "\E" are actually part of double-quotish syntax, and not part of regexp
syntax proper. They will work if they appear in a regular expression embedded directly in a program, but not
when contained in a string that is interpolated in a pattern.
With the advent of 5.6.0, Perl regexps can handle more than just the standard ASCII character set. Perl now
supports Unicode, a standard for representing the alphabets from virtually all of the world's written
languages, and a host of symbols. Perl's text strings are Unicode strings, so they can contain characters
with a value (codepoint or character number) higher than 255.
What does this mean for regexps? Well, regexp users don't need to know much about Perl's internal
representation of strings. But they do need to know 1) how to represent Unicode characters in a regexp and 2)
that a matching operation will treat the string to be searched as a sequence of characters, not bytes. The
answer to 1) is that Unicode characters greater than "chr(255)" are represented using the "\x{hex}" notation,
because \x hex (without curly braces) doesn't go further than 255. (Starting in Perl 5.14, if you're an octal
fan, you can also use "\o{oct}".)
/\x{263a}/; # match a Unicode smiley face :)
NOTE: In Perl 5.6.0 it used to be that one needed to say "use utf8" to use any Unicode features. This is no
more the case: for almost all Unicode processing, the explicit "utf8" pragma is not needed. (The only case
where it matters is if your Perl script is in Unicode and encoded in UTF-8, then an explicit "use utf8" is
needed.)
Figuring out the hexadecimal sequence of a Unicode character you want or deciphering someone else's
hexadecimal Unicode regexp is about as much fun as programming in machine code. So another way to specify
Unicode characters is to use the named character escape sequence "\N{name}". name is a name for the Unicode
character, as specified in the Unicode standard. For instance, if we wanted to represent or match the
astrological sign for the planet Mercury, we could use
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use "short" names:
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
print "\N{greek:Sigma} is an upper-case sigma.\n";
You can also restrict names to a certain alphabet by specifying the charnames pragma:
'unicode_strings' is turned on.) Internally, this is encoded to bytes using either UTF-8 or a native 8 bit
encoding, depending on the history of the string, but conceptually it is a sequence of characters, not bytes.
See perlunitut for a tutorial about that.
Let us now discuss Unicode character classes. Just as with Unicode characters, there are named Unicode
character classes represented by the "\p{name}" escape sequence. Closely associated is the "\P{name}"
character class, which is the negation of the "\p{name}" class. For example, to match lower and uppercase
characters,
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
(The "Is" is optional.)
Here is the association between some Perl named classes and the traditional Unicode classes:
Perl class name Unicode class name or regular expression
IsAlpha /^[LM]/
IsAlnum /^[LMN]/
IsASCII $code <= 127
IsCntrl /^C/
IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
IsDigit Nd
IsGraph /^([LMNPS]|Co)/
IsLower Ll
IsPrint /^([LMNPS]|Co|Zs)/
IsPunct /^P/
IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
IsUpper /^L[ut]/
IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
You can also use the official Unicode class names with "\p" and "\P", like "\p{L}" for Unicode 'letters',
"\p{Lu}" for uppercase letters, or "\P{Nd}" for non-digits. If a "name" is just one letter, the braces can be
dropped. For instance, "\pM" is the character class of Unicode 'marks', for example accent marks. For the
full list see perlunicode.
Unicode has also been separated into various sets of characters which you can test with "\p{...}" (in) and
"\P{...}" (not in). To test whether a character is (or is not) an element of a script you would use the
script name, for example "\p{Latin}", "\p{Greek}", or "\P{Katakana}".
What we have described so far is the single form of the "\p{...}" character classes. There is also a compound
form which you may run into. These look like "\p{name=value}" or "\p{name:value}" (the equals sign and colon
can be used interchangeably). These are more general than the single form, and in fact most of the single
forms are just Perl-defined shortcuts for common compound forms. For example, the script examples in the
previous paragraph could be written equivalently as "\p{Script=Latin}", "\p{Script:Greek}", and
"\P{script=katakana}" (case is irrelevant between the "{}" braces). You may never have to use the compound
forms, but sometimes it is necessary, and their use can make your code easier to understand.
"word" (a Perl extension to match "\w"), and "blank" (a GNU extension). The "//a" modifier restricts these to
matching just in the ASCII range; otherwise they can match the same as their corresponding Perl Unicode
classes: "[:upper:]" is the same as "\p{IsUpper}", etc. (There are some exceptions and gotchas with this; see
perlrecharclass for a full discussion.) The "[:digit:]", "[:word:]", and "[:space:]" correspond to the
familiar "\d", "\w", and "\s" character classes. To negate a POSIX class, put a "^" in front of the name, so
that, e.g., "[:^digit:]" corresponds to "\D" and, under Unicode, "\P{IsDigit}". The Unicode and POSIX
character classes can be used just like "\d", with the exception that POSIX character classes can only be used
inside of a character class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
/^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digit
Whew! That is all the rest of the characters and character classes.
Compiling and saving regular expressions
In Part 1 we mentioned that Perl compiles a regexp into a compact sequence of opcodes. Thus, a compiled
regexp is a data structure that can be stored once and used again and again. The regexp quote "qr//" does
exactly that: "qr/string/" compiles the "string" as a regexp and transforms the result into a form that can be
assigned to a variable:
$reg = qr/foo+bar?/; # reg contains a compiled regexp
Then $reg can be used as a regexp:
$x = "fooooba";
$x =~ $reg; # matches, just like /foo+bar?/
$x =~ /$reg/; # same thing, alternate form
$reg can also be interpolated into a larger regexp:
$x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use different delimiters, e.g., "qr!!", "qr{}" or "qr~~".
Apostrophes as delimiters ("qr''") inhibit any interpolation.
Pre-compiled regexps are useful for creating dynamic matches that don't need to be recompiled each time they
are encountered. Using pre-compiled regexps, we write a "grep_step" program which greps for a sequence of
patterns, advancing to the next pattern as soon as one has been satisfied.
% cat > grep_step
#!/usr/bin/perl
# grep_step - match <number> regexps, one after the other
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
if ($line =~ /$compiled[0]/) {
print $line;
recompilation, thus gaining flexibility without sacrificing speed.
Composing regular expressions at runtime
Backtracking is more efficient than repeated tries with different regular expressions. If there are several
regular expressions and a match with any of them is acceptable, then it is possible to combine them into a set
of alternatives. If the individual expressions are input data, this can be done by programming a join
operation. We'll exploit this idea in an improved version of the "simple_grep" program: a program that
matches multiple patterns:
% cat > multi_grep
#!/usr/bin/perl
# multi_grep - match any of <number> regexps
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
$pattern = join '|', @regexp;
while ($line = <>) {
print $line if $line =~ /$pattern/;
}
^D
% multi_grep 2 shift for multi_grep
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
Sometimes it is advantageous to construct a pattern from the input that is to be analyzed and use the
permissible values on the left hand side of the matching operations. As an example for this somewhat
paradoxical situation, let's assume that our input contains a command verb which should match one out of a set
of available command verbs, with the additional twist that commands may be abbreviated as long as the given
string is unique. The program below demonstrates the basic algorithm.
% cat > keymatch
#!/usr/bin/perl
$kwds = 'copy compare list print';
while( $command = <> ){
$command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
print "command: '@matches'\n";
} elsif( @matches == 0 ){
print "no such command: '$command'\n";
} else {
print "not unique: '$command' (could be one of: @matches)\n";
}
}
^D
% keymatch
li
command: 'list'
co
not unique: 'co' (could be one of: copy compare)
printer
"{n,}?". Most of the extensions below have the form "(?char...)", where the "char" is a character that
determines the type of extension.
The first extension is an embedded comment "(?#text)". This embeds a comment into the regular expression
without affecting its meaning. The comment should not have any closing parentheses in the text. An example
is
/(?# Match an integer:)[+-]?\d+/;
This style of commenting has been largely superseded by the raw, freeform commenting that is allowed with the
"//x" modifier.
Most modifiers, such as "//i", "//m", "//s" and "//x" (or any combination thereof) can also be embedded in a
regexp using "(?i)", "(?m)", "(?s)", and "(?x)". For instance,
/(?i)yes/; # match 'yes' case insensitively
/yes/i; # same thing
/(?x)( # freeform version of an integer regexp
[+-]? # match an optional sign
\d+ # match a sequence of digits
)
/x;
Embedded modifiers can have two important advantages over the usual modifiers. Embedded modifiers allow a
custom set of modifiers to each regexp pattern. This is great for matching an array of regexps that must have
different modifiers:
$pattern[0] = '(?i)doctor';
$pattern[1] = 'Johnson';
...
while (<>) {
foreach $patt (@pattern) {
print if /$patt/;
}
}
The second advantage is that embedded modifiers (except "//p", which modifies the entire regexp) only affect
the regexp inside the group the embedded modifier is contained in. So grouping can be used to localize the
modifier's effects:
/Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
Embedded modifiers can also turn off any modifiers already present by using, e.g., "(?-i)". Modifiers can
also be combined into a single expression, e.g., "(?s-i)" turns on single line mode and turns off case
insensitivity.
Embedded modifiers may also be added to a non-capturing grouping. "(?i-m:regexp)" is a non-capturing grouping
that matches "regexp" case insensitively and turns off multi-line mode.
Looking ahead and looking behind
This section concerns the lookahead and lookbehind assertions. First, a little background.
In Perl regular expressions, most regexp elements 'eat up' a certain amount of string when they match. For
instance, the regexp element "[abc}]" eats up one character of the string when it matches, in the sense that
after. "\b" looks both ahead and behind, to see if the characters on either side differ in their "word-ness".
The lookahead and lookbehind assertions are generalizations of the anchor concept. Lookahead and lookbehind
are zero-width assertions that let us specify which characters we want to test for. The lookahead assertion
is denoted by "(?=regexp)" and the lookbehind assertion is denoted by "(?<=fixed-regexp)". Some examples are
$x = "I catch the housecat 'Tom-cat' with catnip";
$x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
$x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
# middle of $x
Note that the parentheses in "(?=regexp)" and "(?<=regexp)" are non-capturing, since these are zero-width
assertions. Thus in the second regexp, the substrings captured are those of the whole regexp itself.
Lookahead "(?=regexp)" can match arbitrary regexps, but lookbehind "(?<=fixed-regexp)" only works for regexps
of fixed width, i.e., a fixed number of characters long. Thus "(?<=(ab|bc))" is fine, but "(?<=(ab)*)" is
not. The negated versions of the lookahead and lookbehind assertions are denoted by "(?!regexp)" and
"(?<!fixed-regexp)" respectively. They evaluate true if the regexps do not match:
$x = "foobar";
$x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
The "\C" is unsupported in lookbehind, because the already treacherous definition of "\C" would become even
more so when going backwards.
Here is an example where a string containing blank-separated words, numbers and single dashes is to be split
into its components. Using "/\s+/" alone won't work, because spaces are not required between dashes, or a
word or a dash. Additional places for a split are established by looking ahead and behind:
$str = "one two - --6-8";
@toks = split / \s+ # a run of spaces
| (?<=\S) (?=-) # any non-space followed by '-'
| (?<=-) (?=\S) # a '-' followed by any non-space
/x, $str; # @toks = qw(one two - - - 6 - 8)
Using independent subexpressions to prevent backtracking
Independent subexpressions are regular expressions, in the context of a larger regular expression, that
function independently of the larger regular expression. That is, they consume as much or as little of the
string as they wish without regard for the ability of the larger regexp to match. Independent subexpressions
are represented by "(?>regexp)". We can illustrate their behavior by first considering an ordinary regexp:
$x = "ab";
$x =~ /a*ab/; # matches
This obviously matches, but in the process of matching, the subexpression "a*" first grabbed the "a". Doing
so, however, wouldn't allow the whole regexp to match, so after backtracking, "a*" eventually gave back the
"a" and matched the empty string. Here, what "a*" matched was dependent on what the rest of the regexp
matched.
Here "//g" and "\G" create a 'tag team' handoff of the string from one regexp to the other. Regexps with an
independent subexpression are much like this, with a handoff of the string to the independent subexpression,
and a handoff of the string back to the enclosing regexp.
The ability of an independent subexpression to prevent backtracking can be quite useful. Suppose we want to
match a non-empty string enclosed in parentheses up to two levels deep. Then the following regexp matches:
$x = "abc(de(fg)h"; # unbalanced parentheses
$x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
The regexp matches an open parenthesis, one or more copies of an alternation, and a close parenthesis. The
alternation is two-way, with the first alternative "[^()]+" matching a substring with no parentheses and the
second alternative "\([^()]*\)" matching a substring delimited by parentheses. The problem with this regexp
is that it is pathological: it has nested indeterminate quantifiers of the form "(a+|b)+". We discussed in
Part 1 how nested quantifiers like this could take an exponentially long time to execute if there was no match
possible. To prevent the exponential blowup, we need to prevent useless backtracking at some point. This can
be done by enclosing the inner quantifier as an independent subexpression:
$x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
Here, "(?>[^()]+)" breaks the degeneracy of string partitioning by gobbling up as much of the string as
possible and keeping it. Then match failures fail much more quickly.
Conditional expressions
A conditional expression is a form of if-then-else statement that allows one to choose which patterns are to
be matched, based on some condition. There are two types of conditional expression:
"(?(condition)yes-regexp)" and "(?(condition)yes-regexp|no-regexp)". "(?(condition)yes-regexp)" is like an
'if () {}' statement in Perl. If the "condition" is true, the "yes-regexp" will be matched. If the
"condition" is false, the "yes-regexp" will be skipped and Perl will move onto the next regexp element. The
second form is like an 'if () {} else {}' statement in Perl. If the "condition" is true, the "yes-regexp"
will be matched, otherwise the "no-regexp" will be matched.
The "condition" can have several forms. The first form is simply an integer in parentheses "(integer)". It
is true if the corresponding backreference "\integer" matched earlier in the regexp. The same thing can be
done with a name associated with a capture group, written as "(<name>)" or "('name')". The second form is a
bare zero-width assertion "(?...)", either a lookahead, a lookbehind, or a code assertion (discussed in the
next section). The third set of forms provides tests that return true if the expression is executed within a
recursion ("(R)") or is being called from some capturing group, referenced either by number ("(R1)",
"(R2)",...) or by name ("(R&name)").
The integer or name form of the "condition" allows us to choose, with more flexibility, what to match based on
what matched earlier in the regexp. This searches for words of the form "$x$x" or "$x$y$y$x":
% simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
beriberi
coco
couscous
deed
...
toot
toto
tutu
pattern. This syntactic pattern for this definition group is "(?(DEFINE)(?<name>pattern)...)". An insertion
of a named pattern is written as "(?&name)".
The example below illustrates this feature using the pattern for floating point numbers that was presented
earlier on. The three subpatterns that are used more than once are the optional sign, the digit sequence for
an integer and the decimal fraction. The DEFINE group at the end of the pattern contains their definition.
Notice that the decimal fraction pattern is the first place where we can reuse the integer pattern.
/^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
(?: [eE](?&osg)(?&int) )?
$
(?(DEFINE)
(?<osg>[-+]?) # optional sign
(?<int>\d++) # integer
(?<dec>\.(?&int)) # decimal fraction
)/x
Recursive patterns
This feature (introduced in Perl 5.10) significantly extends the power of Perl's pattern matching. By
referring to some other capture group anywhere in the pattern with the construct "(?group-ref)", the pattern
within the referenced group is used as an independent subpattern in place of the group reference itself.
Because the group reference may be contained within the group it refers to, it is now possible to apply
pattern matching to tasks that hitherto required a recursive parser.
To illustrate this feature, we'll design a pattern that matches if a string contains a palindrome. (This is a
word or a sentence that, while ignoring spaces, interpunctuation and case, reads the same backwards as
forwards. We begin by observing that the empty string or a string containing just one word character is a
palindrome. Otherwise it must have a word character up front and the same at its end, with another palindrome
in between.
/(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
Adding "\W*" at either end to eliminate what is to be ignored, we already have the full pattern:
my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
print "'$s' is a palindrome\n" if $s =~ /$pp/;
}
In "(?...)" both absolute and relative backreferences may be used. The entire pattern can be reinserted with
"(?R)" or "(?0)". If you prefer to name your groups, you can use "(?&name)" to recurse into that group.
A bit of magic: executing Perl code in a regular expression
Normally, regexps are a part of Perl expressions. Code evaluation expressions turn that around by allowing
arbitrary Perl code to be a part of a regexp. A code evaluation expression is denoted "(?{code})", with code
a string of Perl statements.
Be warned that this feature is considered experimental, and may be changed without notice.
Code expressions are zero-width assertions, and the value they return depends on their environment. There are
two possibilities: either the code expression is used as a conditional in a conditional expression
"(?(condition)...)", or it is not. If the code expression is a conditional, the code is evaluated and the
result (i.e., the result of the last statement) is used to determine truth or falsehood. If the code
expression is not used as a conditional, the assertion always evaluates true and the result is put into the
# no 'Hi Mom!'
# but why not?
At first glance, you'd think that it shouldn't print, because obviously the "ddd" isn't going to match the
target string. But look at this example:
$x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
# but _does_ print
Hmm. What happened here? If you've been following along, you know that the above pattern should be effectively
(almost) the same as the last one; enclosing the "d" in a character class isn't going to change what it
matches. So why does the first not print while the second one does?
The answer lies in the optimizations the regex engine makes. In the first case, all the engine sees are plain
old characters (aside from the "?{}" construct). It's smart enough to realize that the string 'ddd' doesn't
occur in our target string before actually running the pattern through. But in the second case, we've tricked
it into thinking that our pattern is more complicated. It takes a look, sees our character class, and decides
that it will have to actually run the pattern to determine whether or not it matches, and in the process of
running it hits the print statement before it discovers that we don't have a match.
To take a closer look at how the engine does optimizations, see the section "Pragmas and debugging" below.
More fun with "?{}":
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
# prints '1'
$x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
# prints '1'
The bit of magic mentioned in the section title occurs when the regexp backtracks in the process of searching
for a match. If the regexp backtracks over a code expression and if the variables used within are localized
using "local", the changes in the variables produced by the code expression are undone! Thus, if we wanted to
count how many times a character got matched inside a group, we could use, e.g.,
$x = "aaaa";
$count = 0; # initialize 'a' count
$c = "bob"; # test if $c gets clobbered
$x =~ /(?{local $c = 0;}) # initialize count
( a # match 'a'
(?{local $c = $c + 1;}) # increment count
)* # do this any number of times,
aa # but match 'aa' at the end
(?{$count = $c;}) # copy local $c var into $count
/x;
print "'a' count is $count, \$c variable is '$c'\n";
This prints
'a' count is 2, $c variable is 'bob'
If we replace the " (?{local $c = $c + 1;})" with " (?{$c = $c + 1;})", the variable changes are not undone
during backtracking, and we get
Yow
Yow
Yow
The result $^R is automatically localized, so that it will behave properly in the presence of backtracking.
This example uses a code expression in a conditional to match a definite article, either 'the' in English or
'der|die|das' in German:
$lang = 'DE'; # use German
...
$text = "das";
print "matched\n"
if $text =~ /(?(?{
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
(der|die|das) # else, match 'der|die|das'
)
/xi;
Note that the syntax here is "(?(?{...})yes-regexp|no-regexp)", not "(?((?{...}))yes-regexp|no-regexp)". In
other words, in the case of a code expression, we don't need the extra parentheses around the conditional.
If you try to use code expressions with interpolating variables, Perl may surprise you:
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
/foo(?{ 1 })$bar/; # compile error!
/foo${pat}bar/; # compile error!
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles ok
If a regexp has (1) code expressions and interpolating variables, or (2) a variable that interpolates a code
expression, Perl treats the regexp as an error. If the code expression is precompiled into a variable,
however, interpolating is ok. The question is, why is this an error?
The reason is that variable interpolation and code expressions together pose a security risk. The combination
is dangerous because many programmers who write search engines often take user input and plug it directly into
a regexp:
$regexp = <>; # read user-supplied regexp
$chomp $regexp; # get rid of possible newline
$text =~ /$regexp/; # search $text for the $regexp
If the $regexp variable contains a code expression, the user could then execute arbitrary Perl code. For
instance, some joker could search for "system('rm -rf *');" to erase your files. In this sense, the
combination of interpolation and code expressions taints your regexp. So by default, using both interpolation
and code expressions in the same regexp is not allowed. If you're not concerned about malicious users, it is
possible to bypass this security check by invoking "use re 'eval'":
use re 'eval'; # throw caution out the door
$x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
This final example contains both ordinary and pattern code expressions. It detects whether a binary string
1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,... of the 1's:
$x = "1101010010001000001";
$z0 = ''; $z1 = '0'; # initial conditions
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
(?:
((??{ $z0 })) # match some '0'
1 # and then a '1'
(?{ $z0 = $z1; $z1 .= $^N; })
)+ # repeat as needed
$ # that is all there is
/x;
printf "Largest sequence matched was %d\n", length($z1)-length($z0);
Remember that $^N is set to whatever was matched by the last completed capture group. This prints
It is a Fibonacci sequence
Largest sequence matched was 5
Ha! Try that with your garden variety regexp package...
Note that the variables $z0 and $z1 are not substituted when the regexp is compiled, as happens for ordinary
variables outside a code expression. Rather, the code expressions are evaluated when Perl encounters them
during the search for a match.
The regexp without the "//x" modifier is
/^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
which shows that spaces are still possible in the code parts. Nevertheless, when working with code and
conditional expressions, the extended form of regexps is almost necessary in creating and debugging regexps.
Backtracking control verbs
Perl 5.10 introduced a number of control verbs intended to provide detailed control over the backtracking
process, by directly influencing the regexp engine and by providing monitoring techniques. As all the
features in this group are experimental and subject to change or removal in a future version of Perl, the
interested reader is referred to "Special Backtracking Control Verbs" in perlre for a detailed description.
Below is just one example, illustrating the control verb "(*FAIL)", which may be abbreviated as "(*F)". If
this is inserted in a regexp it will cause it to fail, just as it would at some mismatch between the pattern
and the string. Processing of the regexp continues as it would after any "normal" failure, so that, for
instance, the next position in the string or another alternative will be tried. As failing to match doesn't
preserve capture groups or produce results, it may be necessary to use this in combination with embedded code.
%count = ();
"supercalifragilisticexpialidocious" =~
/([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
The pattern begins with a class matching a subset of letters. Whenever this matches, a statement like
Speaking of debugging, there are several pragmas available to control and debug regexps in Perl. We have
already encountered one pragma in the previous section, "use re 'eval';", that allows variable interpolation
and code expressions to coexist in a regexp. The other pragmas are
use re 'taint';
$tainted = <>;
@parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
The "taint" pragma causes any substrings from a match with a tainted variable to be tainted as well. This is
not normally the case, as regexps are often used to extract the safe bits from a tainted variable. Use
"taint" when you are not extracting safe bits, but are performing some other processing. Both "taint" and
"eval" pragmas are lexically scoped, which means they are in effect only until the end of the block enclosing
the pragmas.
use re '/m'; # or any other flags
$multiline_string =~ /^foo/; # /m is implied
The "re '/flags'" pragma (introduced in Perl 5.14) turns on the given regular expression flags until the end
of the lexical scope. See "'/flags' mode" in re for more detail.
use re 'debug';
/^(.*)$/s; # output debugging info
use re 'debugcolor';
/^(.*)$/s; # output debugging info in living color
The global "debug" and "debugcolor" pragmas allow one to get detailed debugging info about regexp compilation
and execution. "debugcolor" is the same as debug, except the debugging information is displayed in color on
terminals that can display termcap color sequences. Here is example output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
Compiling REx 'a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
4: PLUS(7)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
floating 'bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx 'a*b+c' against 'abc'...
Found floating substr 'bc' at offset 1...
Guessed: match at offset 0
Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
9: END(0)
describes the compilation stage. STAR(4) means that there is a starred object, in this case 'a', and if it
matches, goto line 4, i.e., PLUS(7). The middle lines describe some heuristics and optimizations performed
before a match:
floating 'bc' at 0..2147483647 (checking floating) minlen 2
Guessing start of match, REx 'a*b+c' against 'abc'...
Found floating substr 'bc' at offset 1...
Guessed: match at offset 0
Then the match is executed and the remaining lines describe the process:
Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
0 <> <abc> | 1: STAR
EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
1 <a> <bc> | 4: PLUS
EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
2 <ab> <c> | 7: EXACT <c>
3 <abc> <> | 9: END
Match successful!
Freeing REx: 'a*b+c'
Each step is of the form "n <x> <y>", with "<x>" the part of the string matched and "<y>" the part not yet
matched. The "| 1: STAR" says that Perl is at line number 1 in the compilation list above. See "Debugging
Regular Expressions" in perldebguts for much more detail.
An alternative method of debugging regexps is to embed "print" statements within the regexp. This provides a
blow-by-blow account of the backtracking in an alternation:
"that this" =~ m@(?{print "Start at position ", pos, "\n";})
t(?{print "t1\n";})
h(?{print "h1\n";})
i(?{print "i1\n";})
s(?{print "s1\n";})
|
t(?{print "t2\n";})
h(?{print "h2\n";})
a(?{print "a2\n";})
t(?{print "t2\n";})
(?{print "Done at position ", pos, "\n";})
@x;
prints
Start at position 0
t1
h1
t2
h2
a2
Operators" in perlop. For information on the "split" operation, see "split" in perlfunc.
For an excellent all-around resource on the care and feeding of regular expressions, see the book Mastering
Regular Expressions by Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
AUTHOR AND COPYRIGHT
Copyright (c) 2000 Mark Kvale All rights reserved.
This document may be distributed under the same terms as Perl itself.
Acknowledgments
The inspiration for the stop codon DNA example came from the ZIP code example in chapter 7 of Mastering
Regular Expressions.
The author would like to thank Jeff Pinyan, Andrew Johnson, Peter Haworth, Ronald J Kimball, and Joe Smith for
all their helpful comments.
perl v5.16.3 2013-03-04 PERLRETUT(1)
Back to main site | Back to man page index